ID: 912489441_912489446

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 912489441 912489446
Species Human (GRCh38) Human (GRCh38)
Location 1:110053825-110053847 1:110053849-110053871
Sequence CCCTGAGGACTTTCAGATGAACT TGACCTCTGGTTAGAAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 165} {0: 1, 1: 0, 2: 3, 3: 19, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!