ID: 912502846_912502849

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 912502846 912502849
Species Human (GRCh38) Human (GRCh38)
Location 1:110133683-110133705 1:110133706-110133728
Sequence CCTTGCCAGGAGTCATCCTTTGT CTTCAAAGCAAATTCCTCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!