ID: 912506222_912506232

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 912506222 912506232
Species Human (GRCh38) Human (GRCh38)
Location 1:110158388-110158410 1:110158420-110158442
Sequence CCTTGGGCTTGCACGTGCATGTC TCCAGGGCGTTGTGGGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96} {0: 1, 1: 0, 2: 1, 3: 6, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!