ID: 912508567_912508569

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 912508567 912508569
Species Human (GRCh38) Human (GRCh38)
Location 1:110173130-110173152 1:110173144-110173166
Sequence CCACTTGGACTGAAAGAACCCAA AGAACCCAAGTAAAAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 131} {0: 1, 1: 0, 2: 0, 3: 34, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!