ID: 912515093_912515102

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 912515093 912515102
Species Human (GRCh38) Human (GRCh38)
Location 1:110212070-110212092 1:110212088-110212110
Sequence CCCCACGAGGGAGGCGCGGGCCA GGCCATGGCGCCGGGTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87} {0: 1, 1: 0, 2: 1, 3: 15, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!