ID: 912525485_912525490

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 912525485 912525490
Species Human (GRCh38) Human (GRCh38)
Location 1:110279768-110279790 1:110279821-110279843
Sequence CCTGGTTCCCTGTGGGCTTTAGG TGGAGTCTCACTCTGTTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 201} {0: 616, 1: 2248, 2: 6221, 3: 10880, 4: 14828}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!