ID: 912537327_912537332

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 912537327 912537332
Species Human (GRCh38) Human (GRCh38)
Location 1:110384578-110384600 1:110384612-110384634
Sequence CCACAGGGGTCTAGAGGGGAACC TGCATTCACTCGTAAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126} {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!