ID: 912567668_912567672

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 912567668 912567672
Species Human (GRCh38) Human (GRCh38)
Location 1:110599886-110599908 1:110599901-110599923
Sequence CCAGGTACTTTCACACCCTGCAC CCCTGCACCCAGGTTTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 138} {0: 1, 1: 0, 2: 2, 3: 33, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!