ID: 912577642_912577647

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912577642 912577647
Species Human (GRCh38) Human (GRCh38)
Location 1:110688425-110688447 1:110688476-110688498
Sequence CCAGTCAGCCCAATTTCTGCCAA TTGAAGACAGAAGACATGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 38, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!