ID: 912594040_912594047

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 912594040 912594047
Species Human (GRCh38) Human (GRCh38)
Location 1:110856395-110856417 1:110856417-110856439
Sequence CCATCTCCTCCGCTGCCACAGTG GGTAGGCTCAGTTGGAAGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!