ID: 912679881_912679892

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 912679881 912679892
Species Human (GRCh38) Human (GRCh38)
Location 1:111722301-111722323 1:111722328-111722350
Sequence CCACAGCACCTTTAGGCCATTAG CAGGGTGGCCGGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86} {0: 1, 1: 0, 2: 9, 3: 105, 4: 942}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!