ID: 912679882_912679892

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 912679882 912679892
Species Human (GRCh38) Human (GRCh38)
Location 1:111722309-111722331 1:111722328-111722350
Sequence CCTTTAGGCCATTAGTTTCCAGG CAGGGTGGCCGGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 9, 3: 105, 4: 942}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!