ID: 912682407_912682418

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 912682407 912682418
Species Human (GRCh38) Human (GRCh38)
Location 1:111737922-111737944 1:111737966-111737988
Sequence CCCCAGAGCTGGCCCCTAACACA AGGAAGAGTGTAGCCTTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!