ID: 912698884_912698895

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 912698884 912698895
Species Human (GRCh38) Human (GRCh38)
Location 1:111861548-111861570 1:111861569-111861591
Sequence CCTTGTTCCTGTGTTTACGGAGG GGGAAGCGGGTGGCAGGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 171, 4: 1355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!