ID: 912710774_912710786

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 912710774 912710786
Species Human (GRCh38) Human (GRCh38)
Location 1:111948359-111948381 1:111948402-111948424
Sequence CCTGTGATTCACAGGGCAGAAAG AGGGAGGCGGCAGCCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188} {0: 1, 1: 0, 2: 6, 3: 75, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!