ID: 912738725_912738729

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 912738725 912738729
Species Human (GRCh38) Human (GRCh38)
Location 1:112173981-112174003 1:112173997-112174019
Sequence CCCTGCAGGTCCAGGAAAGGAGT AAGGAGTCTCCATTTGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!