ID: 912830715_912830724 |
View in Genome Browser |
Spacer: 28 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 912830715 | 912830724 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 1:112951172-112951194 | 1:112951223-112951245 |
Sequence | CCTATAACACTCCCTTCCTGCAA | TATTACAAATGAAAAGTGGGGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 197} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |