ID: 912895866_912895868

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 912895866 912895868
Species Human (GRCh38) Human (GRCh38)
Location 1:113588319-113588341 1:113588338-113588360
Sequence CCAGAGTGGTTGGATACAATGTG TGTGGACAATGCATTCTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 161} {0: 1, 1: 0, 2: 1, 3: 25, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!