ID: 912907012_912907016

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 912907012 912907016
Species Human (GRCh38) Human (GRCh38)
Location 1:113718208-113718230 1:113718253-113718275
Sequence CCAGTGGGGGAGTCAAATTTTAA ACTCCAGGTCTCACACATCCAGG
Strand - +
Off-target summary {0: 1, 1: 129, 2: 435, 3: 674, 4: 1086} {0: 1, 1: 1, 2: 5, 3: 14, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!