ID: 912920973_912920985

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 912920973 912920985
Species Human (GRCh38) Human (GRCh38)
Location 1:113866828-113866850 1:113866861-113866883
Sequence CCCTCCACCCCCTGGGGTCAAGT CTTCAGCCTCCCAGGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 96, 3: 488, 4: 1358} {0: 220, 1: 8844, 2: 111606, 3: 218720, 4: 255191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!