ID: 912921019_912921025

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 912921019 912921025
Species Human (GRCh38) Human (GRCh38)
Location 1:113867235-113867257 1:113867263-113867285
Sequence CCCTAAAACTTACCCTAAAACTA TTTGAGAGACTCAGTGTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 507} {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!