ID: 912949545_912949549

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 912949545 912949549
Species Human (GRCh38) Human (GRCh38)
Location 1:114111371-114111393 1:114111393-114111415
Sequence CCAAGGGCACACAGCTACTAAAT TGGCACAGCCAGGATGTGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 36, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!