ID: 912952119_912952130

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 912952119 912952130
Species Human (GRCh38) Human (GRCh38)
Location 1:114127413-114127435 1:114127462-114127484
Sequence CCTTCTCTAGAGGAGCCTTGGCC GTCCTGTTGGCTTTAGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!