ID: 912952119_912952133

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 912952119 912952133
Species Human (GRCh38) Human (GRCh38)
Location 1:114127413-114127435 1:114127464-114127486
Sequence CCTTCTCTAGAGGAGCCTTGGCC CCTGTTGGCTTTAGAACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143} {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!