ID: 912953797_912953803

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 912953797 912953803
Species Human (GRCh38) Human (GRCh38)
Location 1:114138447-114138469 1:114138491-114138513
Sequence CCACTTCATCACCATCATCACCA CTATACGGCAGGCAGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 70, 3: 414, 4: 1610} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!