ID: 912961656_912961659

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 912961656 912961659
Species Human (GRCh38) Human (GRCh38)
Location 1:114201405-114201427 1:114201431-114201453
Sequence CCATGGGCACTAGAGGGGTGAGA AGCAAAAATGAACCTGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!