ID: 912963229_912963230

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 912963229 912963230
Species Human (GRCh38) Human (GRCh38)
Location 1:114214413-114214435 1:114214458-114214480
Sequence CCAGTGGGGTGCTGGTAAACTGT AAAGAAAGAAAGCATTTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!