ID: 912965690_912965697

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 912965690 912965697
Species Human (GRCh38) Human (GRCh38)
Location 1:114235300-114235322 1:114235350-114235372
Sequence CCTGACTTTCCAGTCCTCAGTTC CTTTTTCTCCAGAAGCCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!