ID: 913011747_913011753

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 913011747 913011753
Species Human (GRCh38) Human (GRCh38)
Location 1:114690165-114690187 1:114690206-114690228
Sequence CCTGCTCTGCACTTAACACCTCC CATTTCTTAATCTGTAAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200} {0: 1, 1: 10, 2: 96, 3: 649, 4: 3254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!