|
Left Crispr |
Right Crispr |
| Crispr ID |
913032117 |
913032121 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:114918450-114918472
|
1:114918480-114918502
|
| Sequence |
CCAGAATATCTTGGGCTATTCTG |
TGTGGTTCTATATAAATTTTAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 26, 1: 447, 2: 1194, 3: 2272, 4: 2780} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|