ID: 913042863_913042867

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 913042863 913042867
Species Human (GRCh38) Human (GRCh38)
Location 1:115045459-115045481 1:115045480-115045502
Sequence CCATTTAAGATAAACCCACACCT CTAACATCACATATTGAACACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!