ID: 913070613_913070626

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 913070613 913070626
Species Human (GRCh38) Human (GRCh38)
Location 1:115295158-115295180 1:115295196-115295218
Sequence CCACCATCGCTCCCCAAATTCCA TGGAGAATGGGGAGGTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!