ID: 913105143_913105146

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 913105143 913105146
Species Human (GRCh38) Human (GRCh38)
Location 1:115607423-115607445 1:115607467-115607489
Sequence CCTCCAAAAACTATGCAGATTAA CTCTTAACCCACATCTATATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!