ID: 913117691_913117697

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 913117691 913117697
Species Human (GRCh38) Human (GRCh38)
Location 1:115712004-115712026 1:115712022-115712044
Sequence CCCAGAGCCTGAGGCTGAGACAC GACACAAGGGTGAATAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 317} {0: 1, 1: 0, 2: 4, 3: 24, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!