ID: 913117692_913117697

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913117692 913117697
Species Human (GRCh38) Human (GRCh38)
Location 1:115712005-115712027 1:115712022-115712044
Sequence CCAGAGCCTGAGGCTGAGACACA GACACAAGGGTGAATAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 334} {0: 1, 1: 0, 2: 4, 3: 24, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!