ID: 913158159_913158163

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 913158159 913158163
Species Human (GRCh38) Human (GRCh38)
Location 1:116120670-116120692 1:116120721-116120743
Sequence CCTGGCACCTGCTACATAGTAGG TGTTACAGAAAAGAACATTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 275} {0: 1, 1: 1, 2: 11, 3: 157, 4: 1407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!