|
Left Crispr |
Right Crispr |
| Crispr ID |
913187769 |
913187773 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:116385580-116385602
|
1:116385595-116385617
|
| Sequence |
CCCATAGCCCTTATTACAGTCGT |
ACAGTCGTTTGTTATAATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 39, 3: 89, 4: 132} |
{0: 1, 1: 34, 2: 88, 3: 125, 4: 171} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|