ID: 913193478_913193481

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913193478 913193481
Species Human (GRCh38) Human (GRCh38)
Location 1:116433257-116433279 1:116433274-116433296
Sequence CCAGGGCAGCTGCAGCCCAAGGC CAAGGCAAGTGTTTCTAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 428} {0: 1, 1: 0, 2: 1, 3: 9, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!