ID: 913222057_913222070

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 913222057 913222070
Species Human (GRCh38) Human (GRCh38)
Location 1:116667623-116667645 1:116667665-116667687
Sequence CCCTGGCCCTCTCCCTCCGCGCG CCATCCAGGCGCACGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 285} {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!