ID: 913224506_913224515

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 913224506 913224515
Species Human (GRCh38) Human (GRCh38)
Location 1:116687168-116687190 1:116687188-116687210
Sequence CCCTCCCCATTCTGCCTGTGGAG GAGAAGTCTGGCCCTGCTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!