ID: 913249538_913249546

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 913249538 913249546
Species Human (GRCh38) Human (GRCh38)
Location 1:116901117-116901139 1:116901153-116901175
Sequence CCCTGGCATTCTGTATGCCACAC TGCAGCACAAGGATGGGCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!