ID: 913271437_913271438

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913271437 913271438
Species Human (GRCh38) Human (GRCh38)
Location 1:117097549-117097571 1:117097566-117097588
Sequence CCTTGCTTTGTATGTGTCTATAG CTATAGATACAGATCTAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 320} {0: 1, 1: 0, 2: 0, 3: 3, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!