ID: 913280274_913280282

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 913280274 913280282
Species Human (GRCh38) Human (GRCh38)
Location 1:117178875-117178897 1:117178919-117178941
Sequence CCACCACACCCAGCCTTATGAAT GCCCTGTGTATTCCATCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!