ID: 913282216_913282225

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 913282216 913282225
Species Human (GRCh38) Human (GRCh38)
Location 1:117197311-117197333 1:117197359-117197381
Sequence CCCCTCCCCCTTCTCATTGCTCT GATATTTTTGACTTTTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 89, 4: 1034} {0: 1, 1: 0, 2: 0, 3: 28, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!