ID: 913283631_913283633

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 913283631 913283633
Species Human (GRCh38) Human (GRCh38)
Location 1:117208525-117208547 1:117208560-117208582
Sequence CCATTGTCTAGTGCAATATTCAG GCTCAGTTAATATTGTTGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 22, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!