ID: 913300885_913300890

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 913300885 913300890
Species Human (GRCh38) Human (GRCh38)
Location 1:117367443-117367465 1:117367456-117367478
Sequence CCTGACAGACCCGTGCGGTAGCA TGCGGTAGCAACAGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 28} {0: 1, 1: 0, 2: 3, 3: 24, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!