ID: 913439774_913439782

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 913439774 913439782
Species Human (GRCh38) Human (GRCh38)
Location 1:118885144-118885166 1:118885184-118885206
Sequence CCGTAGGCTTCCATCTTGCTGTT GAGTTGGTATTCCTGAGATCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 284} {0: 1, 1: 0, 2: 0, 3: 15, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!