ID: 913499865_913499869

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 913499865 913499869
Species Human (GRCh38) Human (GRCh38)
Location 1:119462222-119462244 1:119462254-119462276
Sequence CCCTTGAGGGGATCCTCTGATGT CACCTTCTTGATGTTATATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115} {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!