ID: 913532613_913532625

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 913532613 913532625
Species Human (GRCh38) Human (GRCh38)
Location 1:119743399-119743421 1:119743451-119743473
Sequence CCTGCTGGCCCTGTGGCTGTCCC ACAAAGCCTCCAGCCATGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 421} {0: 1, 1: 0, 2: 0, 3: 27, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!