ID: 913532616_913532623

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 913532616 913532623
Species Human (GRCh38) Human (GRCh38)
Location 1:119743407-119743429 1:119743447-119743469
Sequence CCCTGTGGCTGTCCCTGGTGGCC ACCTACAAAGCCTCCAGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!